ID: 1147945212_1147945225

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147945212 1147945225
Species Human (GRCh38) Human (GRCh38)
Location 17:44076950-44076972 17:44076995-44077017
Sequence CCCCATCCCCATCCCCCAGGAGG CACTATGAACCGATGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 100, 4: 847} {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!