ID: 1147946596_1147946606

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1147946596 1147946606
Species Human (GRCh38) Human (GRCh38)
Location 17:44083805-44083827 17:44083840-44083862
Sequence CCCGATGCCCCCACAAGGCAGCA TCTGGCTGATGGGGCCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210} {0: 1, 1: 0, 2: 2, 3: 45, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!