ID: 1147957034_1147957036

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147957034 1147957036
Species Human (GRCh38) Human (GRCh38)
Location 17:44141873-44141895 17:44141898-44141920
Sequence CCTTTGTGTCGGCGGGAAAGAAA TGCCTGCCCCTTTAAGAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 35} {0: 1, 1: 0, 2: 0, 3: 17, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!