ID: 1147958413_1147958423

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147958413 1147958423
Species Human (GRCh38) Human (GRCh38)
Location 17:44150947-44150969 17:44150997-44151019
Sequence CCCTCCCCTCTTAGCAGAGTGGG GCGCCCCAAACTCCAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 168} {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!