ID: 1147958416_1147958423

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1147958416 1147958423
Species Human (GRCh38) Human (GRCh38)
Location 17:44150951-44150973 17:44150997-44151019
Sequence CCCCTCTTAGCAGAGTGGGAGAA GCGCCCCAAACTCCAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 135} {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!