ID: 1147960012_1147960018

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1147960012 1147960018
Species Human (GRCh38) Human (GRCh38)
Location 17:44161659-44161681 17:44161679-44161701
Sequence CCTTTTGTCATGTACGGGTACAA CAAGGGGAGCAGAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 1, 1: 1, 2: 3, 3: 102, 4: 1269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!