ID: 1147972776_1147972780

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1147972776 1147972780
Species Human (GRCh38) Human (GRCh38)
Location 17:44228595-44228617 17:44228610-44228632
Sequence CCCCCAGGCTTCTGACTCAAACT CTCAAACTCTCTCACTTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187} {0: 1, 1: 0, 2: 2, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!