ID: 1147979256_1147979271

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147979256 1147979271
Species Human (GRCh38) Human (GRCh38)
Location 17:44264785-44264807 17:44264830-44264852
Sequence CCTTCCCCAGGAATGTGAGGGCA CACCTAAGGTGGCCCCAGACTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 280} {0: 1, 1: 0, 2: 3, 3: 4, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!