ID: 1147979671_1147979676

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1147979671 1147979676
Species Human (GRCh38) Human (GRCh38)
Location 17:44266735-44266757 17:44266755-44266777
Sequence CCAGATCGCTGCCCCAAGTTTTG TTGGAAGTGCACCAAACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62} {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!