ID: 1147987224_1147987232

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1147987224 1147987232
Species Human (GRCh38) Human (GRCh38)
Location 17:44313581-44313603 17:44313634-44313656
Sequence CCTGCAGCATCCTTCAGTTCCTG CTGATTTCCCTCTTCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 326} {0: 1, 1: 0, 2: 1, 3: 25, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!