ID: 1147998802_1147998812

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147998802 1147998812
Species Human (GRCh38) Human (GRCh38)
Location 17:44375805-44375827 17:44375838-44375860
Sequence CCAGGTCTTTCTTCCACCCAGCT GAGGGTTGACAGGAGGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 317} {0: 1, 1: 0, 2: 1, 3: 29, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!