ID: 1148002288_1148002291

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1148002288 1148002291
Species Human (GRCh38) Human (GRCh38)
Location 17:44396937-44396959 17:44396954-44396976
Sequence CCAAGATAACAGTGCCAAATGTG AATGTGTGGCTCCGTTGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174} {0: 1, 1: 0, 2: 2, 3: 3, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!