ID: 1148002288_1148002296

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1148002288 1148002296
Species Human (GRCh38) Human (GRCh38)
Location 17:44396937-44396959 17:44396989-44397011
Sequence CCAAGATAACAGTGCCAAATGTG ATTGCAGCCTGAGTTATATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174} {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!