ID: 1148028447_1148028467

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1148028447 1148028467
Species Human (GRCh38) Human (GRCh38)
Location 17:44604266-44604288 17:44604319-44604341
Sequence CCTGGCCCTCTGCCATGCCCACC TTGTGTTTAGGGAGGGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 65, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!