ID: 1148046492_1148046499

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148046492 1148046499
Species Human (GRCh38) Human (GRCh38)
Location 17:44748124-44748146 17:44748174-44748196
Sequence CCCAACCACAGGCTGCAGAGCCA GCGGCAGGTTAGACCCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 513} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!