ID: 1148052649_1148052658

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1148052649 1148052658
Species Human (GRCh38) Human (GRCh38)
Location 17:44776717-44776739 17:44776747-44776769
Sequence CCGCTCAACCCCACCCCTCTCTC CCCGCCTAACCTGCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 145, 4: 1356} {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!