ID: 1148053142_1148053155

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1148053142 1148053155
Species Human (GRCh38) Human (GRCh38)
Location 17:44779108-44779130 17:44779152-44779174
Sequence CCCGGCCCCGCTCTGGGGCAAGG CCCTCCCTGAGAGAAGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 253} {0: 1, 1: 1, 2: 1, 3: 17, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!