ID: 1148096370_1148096374

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1148096370 1148096374
Species Human (GRCh38) Human (GRCh38)
Location 17:45055066-45055088 17:45055094-45055116
Sequence CCTCCATAATGAAACTTGGGCTT TTTCCATGTGATGCCATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 110} {0: 1, 1: 0, 2: 1, 3: 7, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!