ID: 1148105956_1148105968

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1148105956 1148105968
Species Human (GRCh38) Human (GRCh38)
Location 17:45118984-45119006 17:45119036-45119058
Sequence CCGCAGGAACTCCTCGATCTCAG TCACACTCCTGGGGAGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129} {0: 1, 1: 0, 2: 3, 3: 31, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!