ID: 1148122490_1148122506

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148122490 1148122506
Species Human (GRCh38) Human (GRCh38)
Location 17:45221476-45221498 17:45221513-45221535
Sequence CCAGGCCGTGATCCCCTTCACCC CCTCGCCCGAGGCGAGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140} {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!