ID: 1148122545_1148122556

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1148122545 1148122556
Species Human (GRCh38) Human (GRCh38)
Location 17:45221665-45221687 17:45221679-45221701
Sequence CCACTCCCCGCCCGCCATGGTTG CCATGGTTGCGGGGGTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 262} {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!