ID: 1148123819_1148123822

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1148123819 1148123822
Species Human (GRCh38) Human (GRCh38)
Location 17:45226815-45226837 17:45226829-45226851
Sequence CCTTGTCCCAGCTGTGGGGACCC TGGGGACCCTTGAACTCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 545} {0: 1, 1: 0, 2: 1, 3: 15, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!