ID: 1148127874_1148127878

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1148127874 1148127878
Species Human (GRCh38) Human (GRCh38)
Location 17:45246118-45246140 17:45246137-45246159
Sequence CCAGCTGTCCTTGCTGTGGGGGA GGGACCAGGCAGATATTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 248} {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!