ID: 1148131767_1148131770

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1148131767 1148131770
Species Human (GRCh38) Human (GRCh38)
Location 17:45266576-45266598 17:45266589-45266611
Sequence CCAGCACCATGTTCCAGCTGGAG CCAGCTGGAGCTTCGAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203} {0: 1, 1: 0, 2: 1, 3: 16, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!