ID: 1148132541_1148132553

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148132541 1148132553
Species Human (GRCh38) Human (GRCh38)
Location 17:45270743-45270765 17:45270790-45270812
Sequence CCAGTAAAACAGGCCAGAGCCAG GGCCCGGCCCGTTAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 180} {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!