|
Left Crispr |
Right Crispr |
| Crispr ID |
1148151609 |
1148151621 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:45399882-45399904
|
17:45399921-45399943
|
| Sequence |
CCCAGCCAGGCACAACGGCTCAT |
CTTTGGAAGGGCAAGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 88, 3: 621, 4: 2382} |
{0: 8, 1: 1132, 2: 25663, 3: 79938, 4: 159545} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|