ID: 1148156892_1148156907

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1148156892 1148156907
Species Human (GRCh38) Human (GRCh38)
Location 17:45429824-45429846 17:45429875-45429897
Sequence CCGCACGGGCGCCGCGGGCCGCA CAGGCTGCTGCGCTGGGTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 114} {0: 2, 1: 1, 2: 1, 3: 23, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!