ID: 1148161359_1148161365

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148161359 1148161365
Species Human (GRCh38) Human (GRCh38)
Location 17:45451964-45451986 17:45451995-45452017
Sequence CCCATCCTCGCGGGGCCAACCGC TCCTTTCAGATGCTTGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 30} {0: 1, 1: 1, 2: 0, 3: 21, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!