ID: 1148172271_1148172276

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1148172271 1148172276
Species Human (GRCh38) Human (GRCh38)
Location 17:45532245-45532267 17:45532279-45532301
Sequence CCTGCGGGAAGACAGCACTGGGG ATGGGTACCATGTTTCTTTTTGG
Strand - +
Off-target summary No data {0: 4, 1: 5, 2: 42, 3: 232, 4: 972}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!