ID: 1148180587_1148180593

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1148180587 1148180593
Species Human (GRCh38) Human (GRCh38)
Location 17:45602022-45602044 17:45602065-45602087
Sequence CCAGAGAATTATTATTCAGTGTG CGGAAAGAGGTTGAGCGTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!