ID: 1148197993_1148197998

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1148197993 1148197998
Species Human (GRCh38) Human (GRCh38)
Location 17:45728632-45728654 17:45728655-45728677
Sequence CCACATGGAACTTCACCGGGGCA GGTAATTGAACTAGTGGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!