ID: 1148198850_1148198858

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1148198850 1148198858
Species Human (GRCh38) Human (GRCh38)
Location 17:45734538-45734560 17:45734560-45734582
Sequence CCAGCCTCAGGAATGACTTAAAC CCAGGGACTCTGGGGCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 270} {0: 1, 1: 1, 2: 2, 3: 68, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!