ID: 1148214544_1148214549

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1148214544 1148214549
Species Human (GRCh38) Human (GRCh38)
Location 17:45827276-45827298 17:45827312-45827334
Sequence CCCTGGAAGGCAGCACTGAAGGG TGCGCTCCTCCCGCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 336} {0: 1, 1: 0, 2: 1, 3: 17, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!