ID: 1148214827_1148214831

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1148214827 1148214831
Species Human (GRCh38) Human (GRCh38)
Location 17:45828813-45828835 17:45828843-45828865
Sequence CCCGGGAGTTTGGTGTCTCTGCA GGTCCACCTGGTGTTCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!