ID: 1148229118_1148229130

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1148229118 1148229130
Species Human (GRCh38) Human (GRCh38)
Location 17:45920229-45920251 17:45920277-45920299
Sequence CCCTCTGTCCTCCTGTCACCTGG TGCCTGGCTGGAGTTGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 532} {0: 1, 1: 0, 2: 3, 3: 55, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!