ID: 1148244309_1148244313

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148244309 1148244313
Species Human (GRCh38) Human (GRCh38)
Location 17:46020550-46020572 17:46020587-46020609
Sequence CCCGATACTGGGCAGTCTAAAAG GACTCACAGTTCCACGTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 409} {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!