ID: 1148246225_1148246232

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148246225 1148246232
Species Human (GRCh38) Human (GRCh38)
Location 17:46032482-46032504 17:46032532-46032554
Sequence CCATCCCAAGAAAAAAGCATGGC AAGTGCCTAGTGAATTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 311} {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!