ID: 1148264564_1148264569

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1148264564 1148264569
Species Human (GRCh38) Human (GRCh38)
Location 17:46215257-46215279 17:46215275-46215297
Sequence CCCAGAGGCAAAGAACAACAGGG CAGGGTTCACAGAAGGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 247} {0: 1, 1: 0, 2: 2, 3: 21, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!