|
Left Crispr |
Right Crispr |
Crispr ID |
1148278983 |
1148278988 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:46332424-46332446
|
17:46332474-46332496
|
Sequence |
CCTGGGTGACAGAGTGAGACCCT |
CAGCTACTCACCTGGAATACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6598, 1: 26231, 2: 68050, 3: 126125, 4: 184175} |
{0: 2, 1: 4, 2: 2, 3: 14, 4: 164} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|