ID: 1148319174_1148319175

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1148319174 1148319175
Species Human (GRCh38) Human (GRCh38)
Location 17:46735592-46735614 17:46735625-46735647
Sequence CCTACTCTGTTGAGGGTCAGCTA TAGTGAAGCCCTTTGTAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!