ID: 1148323864_1148323867

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1148323864 1148323867
Species Human (GRCh38) Human (GRCh38)
Location 17:46772164-46772186 17:46772178-46772200
Sequence CCGACCGGGGCGCGTATGCGCTC TATGCGCTCGCGGCGTCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 5} {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!