ID: 1148332188_1148332193

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1148332188 1148332193
Species Human (GRCh38) Human (GRCh38)
Location 17:46819516-46819538 17:46819531-46819553
Sequence CCCACAGCCTCAGTGGGATTCTC GGATTCTCGGTTGGACCATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 218} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!