ID: 1148337708_1148337713

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148337708 1148337713
Species Human (GRCh38) Human (GRCh38)
Location 17:46852245-46852267 17:46852276-46852298
Sequence CCAGGGAGAATGGGGGAAACCTC AGAGCGCCAGCTGGAGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195} {0: 1, 1: 0, 2: 0, 3: 11, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!