ID: 1148339498_1148339507

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1148339498 1148339507
Species Human (GRCh38) Human (GRCh38)
Location 17:46864873-46864895 17:46864911-46864933
Sequence CCTCCAGGACACCTTCCAGGAGC TCTGGGCCGGGTGACCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 400} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!