ID: 1148340496_1148340510

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1148340496 1148340510
Species Human (GRCh38) Human (GRCh38)
Location 17:46870637-46870659 17:46870685-46870707
Sequence CCTGGGGCCTGGCCAGGCCGCAT TGGGGCATACAGAGAGGGCATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 86, 4: 293} {0: 1, 1: 0, 2: 8, 3: 53, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!