ID: 1148357168_1148357173

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1148357168 1148357173
Species Human (GRCh38) Human (GRCh38)
Location 17:46983173-46983195 17:46983203-46983225
Sequence CCATTGTCTATTTGCATATTTGG GAACCATCCACGTCAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 389} {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!