ID: 1148376704_1148376711

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1148376704 1148376711
Species Human (GRCh38) Human (GRCh38)
Location 17:47154644-47154666 17:47154672-47154694
Sequence CCCAAACTGCATTTTACATGGAA CTTTTTTGAAGGGGCTCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 275} {0: 8, 1: 4, 2: 2, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!