ID: 1148377065_1148377076

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1148377065 1148377076
Species Human (GRCh38) Human (GRCh38)
Location 17:47158194-47158216 17:47158245-47158267
Sequence CCACCCACCTACCTATTTCACAT GATTTAAACTAAGGCTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 262} {0: 6, 1: 2, 2: 7, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!