ID: 1148425947_1148425952

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1148425947 1148425952
Species Human (GRCh38) Human (GRCh38)
Location 17:47596144-47596166 17:47596182-47596204
Sequence CCGTATCTCAAAAAATACCAGTT ACTTAGTTGCAGAAGAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 854} {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!