ID: 1148436823_1148436834

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148436823 1148436834
Species Human (GRCh38) Human (GRCh38)
Location 17:47692127-47692149 17:47692174-47692196
Sequence CCTGGTATGAGCAGCAGAACTAG GTCCAGATTGGGGGAGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100} {0: 1, 1: 0, 2: 5, 3: 78, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!